The Chapter Skim interface presents what we've algorithmically identified as the most significant single chunk of text within every page in the chapter.
Select key terms on the right to highlight them within pages of the chapter.
From page 17... ...
The evidence for evolution comes not just from the biological sciences but also from both historical and modern research in anthropology, astrophysics, chemistry, geology, physics, mathematics, and other scientific disciplines, including the behavioral and social sciences. Astrophysics and geology have demonstrated that the Earth is old enough for biological evolution to have resulted in the species seen today.
|
From page 18... ...
They are investigating and further elucidating the mechanisms that produce evolutionary change and the consequences of that change. Biological evolution is part of a compelling historical narrative that scien tists have constructed over the last few centuries.
|
From page 19... ...
Such disks an individual cloud became sufficiently compressed by gravity, the hydrogen appear to provide the atoms in that cloud began to fuse into helium atoms, giving off visible light raw materials for the formation of planeand other radiation -- the origin of a star. tesimals that combine Astrophysicists also have found that some stars form in the middle of a flat- to form planets and tened spinning disk of matter.
|
From page 20... ...
formed when the universe cooled after naturally decay into other number of protons the Big Bang. These particles then came together radioactive and nonradio- and neutrons in its to form hydrogen atoms, helium atoms, and small active atoms by emitting nucleus.
|
From page 21... ...
Since the 1950s hundreds of laboratory experiments have shown that Earth's simplest chemical compounds, including water and volcanic gases, could have reacted to form many of the molecular building blocks of life, including the molecules that make up proteins, DNA, and cell membranes. Meteorites from outer space also contain some of these chemical building blocks, and astronomers using radio telescopes have found many of these molecules in interstellar space.
|
From page 22... ...
The history of science shows that even very difficult questions such as how life originated may become amenable to solution as a result of advances in theory, the development of new instrumentation, and the discovery of new facts. The fossil record provides extensive evidence documenting the occurrence of evolution.
|
From page 23... ...
More birdlike fossils from China that are about 110 million years old have smaller tails and clawed appendages. In the more recent fossil record, the evolutionary paths of many modern organisms, such as whales, elephants, armadillos, horses, and humans, have been uncovered.
|
From page 24... ...
ancestor that is now If the common ancestor of two species lived relatively recently, those two extinct. species are likely to have more physical features and behaviors in common than two species with a more distant common ancestor.
|
From page 25... ...
are more closely related to humans connect today's organisms to their common ancestors. Hypotheses based on than they are to this evidence then can be tested by examining the fossil record.
|
From page 26... ...
The larvae of the drosophilid flies such as the example pic fly Drosophila carcinophila tured to evolve into can develop only in specialmore than 500 species ized grooves beneath the in the islands' special flaps of the third pair of oral ized environments. This rampant specia- appendages of a land crab tion was made pos- that is found solely on certain sible in part because islands in the Caribbean.
|
From page 27... ...
Individual species repeatedly served as ancestors for [Speciation: The multiple other species as groups of flies occupied habitats with different eleva- evolutionary processes tions, precipitation, soils, and plants. In addition, small groups of flies -- or through which new species arise from in some cases perhaps a single fertilized female -- periodically flew or were existing species.]
|
From page 28... ...
This new evidence has fully confirmed the general conclusions drawn from the fossil record, the geographic distribution of species, and other types of observations. In addition, it has provided a wealth of new information about the evolutionary relationships among species and about how evolution occurs.
|
From page 29... ...
By comparing the DNA sequences of two organisms, biologists can uncover the genetic changes that have occurred since those organisms shared a common ancestor. If two species have a relatively recent common ancestor, their DNA sequences will be more similar than the DNA sequences for two species that share a distant common ancestor.
|
From page 30... ...
reflecting our relatively recent common ancestry. But human DNA sequences are increasingly different from those of the baboon, mouse, chicken, and puffer fish, reflecting our increasing evolutionary distance from each of those organ isms.
|
From page 31... ...
Where the human ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAAGTCACCGGTTTGGAC human and chimpanzee sequences differ, the corre chimp ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAGGTCACCGGTTTGGAC sponding nucleotide in the gorilla G gorilla (shaded bars) can be used to derive the nucleo gorilla C tide that likely existed in human TTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC the common ancestor of chimp TTCATTCCTGGGCTCCACCCTATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC humans, chimpanzees, and gorillas.
|
From page 32... ...
The DNA evidence suggests that the basic mechanisms controlling biological form became established before or dur ing the evolution of multicellular organisms and have been conserved with little modification ever since. Biological evolution explains the origin and history of our species.
|
From page 33... ...
Using the same scientific methods and tools that have been employed to study the evolution of other species, researchers have compiled a large and increasing number of fossil discoveries and compelling new molecular evidence that clearly indicate that the same forces responsible for the evolution of all other life forms on Earth account for the biological evolution of human characteristics. Based on the strength of evidence from DNA comparisons, the common ancestor of humans and chimpanzees lived approximately 6 to 7 million years ago in Africa.
|
From page 34... ...
The subsequent fossil record includes the skeletal remains of additional species within the genus Homo. The more recent species generally had larger brains than the earlier ones.
|
From page 35... ...
Other closely related species on the human side of the family tree are known from the fossil record. Paranthropus robustus and Neanderthals are extinct evolutionary lineages now repre Evidence shows that anatomically modern humans (Homo sapiens -- "wise" sented only by fossils.
|
Key Terms
This material may be derived from roughly machine-read images, and so is provided only to facilitate research.
More
information on Chapter Skim is available.